KEGG   Bacillus subtilis subsp. subtilis 168: BSU11382
Entry
BSU11382          gene      T00010                                 

Gene name
appA
Definition
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Other DBs
NCBI-GeneID: 8302939
Position
1214001..1215167
NT seq 1167 nt   +upstreamnt  +downstreamnt
ggcgattacgaagtcttgtttaagctgaaatataaagacggtaatttctacaacaatgcg
ttagacagcacagctattctgccgaaacatattctcggtaatgttccgattgctgattta
gaagaaaatgagtttaacagaaagaaaccaatcggttcaggaccatttaagtttaaggaa
tggaagcagggccaatatattaagctcgaagcgaatgatgattactttgaaggaagaccg
tatttagatactgtgacgtataaagtcattcctgacgcaaatgctgccgttgctcagctg
caggcaggcgatattaatttctttaatgtgcccgccactgactacaaaacggctgaaaaa
ttcaacaacctaaaaatcgttactgatttggcattaagttatgtgtacatcgggtggaat
gaaaaaaatgaattattcaaggataaaaaggttcgtcaagcgctaacaaccgctcttgac
cgcgagtcaatcgtcagccaagtattagatggagacggcgaggtagcttacattccggaa
agccctttatcttggaactatcctaaagatatagatgttccgaaatttgagtacaacgag
aaaaaagcgaaacagatgcttgcagaagccggctggaaagatacgaacggtgacggcatt
ctggataaagacggaaagaaattctcgtttacccttaaaacgaaccaaggaaacaaagtc
cgtgaagacatcgctgtcgtcgttcaggaacagctgaaaaaaatcggcattgaagtgaaa
acccagatcgttgaatggagcgctctcgttgaacaaatgaatcctccgaattgggatttt
gatgcaatggtcatgggatggagtttatccacattcccggatcaatatgatattttccat
tcaagccagattaaaaagggtttgaactacgtttggtataaaaatgccgaagcggataaa
ctcatgaaagatgcaaaatcaatcagtgacagaaagcagtattcaaaagaatatgagcaa
atctatcaaaaaattgcggaagatcagccgtatacgttcttgtattatcctaacaaccat
atggcaatgccggaaaatcttgaaggatacaaatatcatccgaaacgtgatttgtataat
attgaaaaatggtggcttgcaaaataa

DBGET integrated database retrieval system