KEGG   Bacillus subtilis subsp. subtilis 168: BSU11680
Entry
BSU11680          CDS       T00010                                 

Gene name
thiS
Definition
(RefSeq) sulfur carrier protein ThiS
  KO
K03154  sulfur carrier protein
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu04122  Sulfur relay system
Module
bsu_M00895  Thiamine biosynthesis, prokaryotes, AIR (+ DXP/glycine) => TMP/TPP
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09123 Folding, sorting and degradation
   04122 Sulfur relay system
    BSU11680 (thiS)
SSDB
Motif
Pfam: ThiS
Other DBs
NCBI-GeneID: 939811
NCBI-ProteinID: NP_389050
Pasteur: BG13148
BSORF: BG13148
UniProt: O31617 A0A6M4JRE4 A0A0A1HAW8
Structure
PDB: 
1TYG

Position
1244844..1245044
AA seq 66 aa
MLQLNGKDVKWKKDTGTIQDLLASYQLENKIVIVERNKEIIGKERYHEVELCDRDVIEIV
HFVGGG
NT seq 201 nt   +upstreamnt  +downstreamnt
atgctacagctgaacggtaaagacgtgaagtggaaaaaagacacaggtacaattcaagac
ctgctggcgtcgtatcagcttgaaaataaaatcgttatcgtggaaagaaataaagaaata
atcgggaaagaacgctatcacgaggttgagctttgtgatcgtgatgtcattgaaattgtc
cattttgtaggaggcggatga

DBGET integrated database retrieval system