KEGG   Bacillus subtilis subsp. subtilis 168: BSU11809
Entry
BSU11809          CDS       T00010                                 

Gene name
yjcZ
Definition
(RefSeq) hypothetical protein
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Motif
Pfam: YjcZ_2
Other DBs
NCBI-GeneID: 8303203
NCBI-ProteinID: YP_003097705
UniProt: C0H3Y8 A0A6M3Z9J2
Position
1253103..1253252
AA seq 49 aa
MGFGYGFGGGYGGGCYGGYAGGYGGGYGSTFVLLVVLFILLIIVGASFF
NT seq 150 nt   +upstreamnt  +downstreamnt
atgggctttggatacggattcggcggcggctacggcggcggctgttatggcggttatgct
ggcggttacggcggcggctatggttcaacatttgttttgttggtcgtattattcattctc
ctcatcatcgtaggtgcatctttcttttaa

DBGET integrated database retrieval system