KEGG   Bacillus subtilis subsp. subtilis 168: BSU12440
Entry
BSU12440          CDS       T00010                                 

Gene name
phrA
Definition
(RefSeq) phosphatase RapA inhibitor
  KO
K06352  phosphatase RapA inhibitor
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu02024  Quorum sensing
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09140 Cellular Processes
  09145 Cellular community - prokaryotes
   02024 Quorum sensing
    BSU12440 (phrA)
SSDB
Other DBs
NCBI-GeneID: 939413
NCBI-ProteinID: NP_389126
Pasteur: BG10653
BSORF: BG10653
UniProt: Q00829 A0A6M3ZA19
Position
1316995..1317129
AA seq 44 aa
MKSKWMSGLLLVAVGFSFTQVMVHAGETANTEGKTFHIAARNQT
NT seq 135 nt   +upstreamnt  +downstreamnt
atgaaatctaaatggatgtcaggtttgttgctcgttgcggtcgggttcagctttactcag
gtgatggttcatgcaggtgaaacagcaaacacagaagggaaaacatttcatattgcggca
cgcaatcaaacatga

DBGET integrated database retrieval system