KEGG   Bacillus subtilis subsp. subtilis 168: BSU13299
Entry
BSU13299          gene      T00010                                 

Gene name
ykzO
Definition
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Other DBs
NCBI-GeneID: 8302951
Position
complement(1395598..1395810)
NT seq 213 nt   +upstreamnt  +downstreamnt
gtgaaagaagcacggcaaaaaaagcgtgcgggcgccttcaatcgtagagctttagcactg
tatggcataggacaagcatccagctgcattaaaaatcaccttatgtcgatgatttctgtt
gacccattggcgtctttggacatttttgggcagcagcgtatctccatacaggagcctcac
ctaacgaagttcctaattgaattgacacactga

DBGET integrated database retrieval system