KEGG   Bacillus subtilis subsp. subtilis 168: BSU14240Help
Entry
BSU14240          CDS       T00010                                 

Gene name
rok
Definition
(RefSeq) repressor rok
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 938793
NCBI-ProteinID: NP_389307
Pasteur: BG13307
BSORF: BG13307
UniProt: O34857
Structure
PDB: 

Position
1493787..1494362
Genome map
AA seq 191 aa AA seqDB search
MFNEREALRLRLEQLNEAEVKVIREYQIERDKIYAKLRELDRNGSPSEIKKDFRSEKKPD
SLPVLAELAAQEIRSYQPQSQQQSVQPQLQSISSLPAGIPDGTTRRRRGTARPGSKAAKL
REAAIKTLKRHNAAIKSSELQKEIEKESGLEIPNMTTFMQSLIKMYPEVKKPYRGQYILE
GEIESAESANE
NT seq 576 nt NT seq  +upstreamnt  +downstreamnt
atgtttaatgaaagagaagctttgcgcttgcggttagaacaattaaatgaagctgaagtg
aaagtcattcgtgaatatcaaattgaacgtgataaaatatacgcaaaattaagagagctg
gacagaaatggaagcccttccgaaatcaaaaaggatttccgttctgaaaaaaaacctgac
tctctgccggttctcgctgagcttgcggctcaggaaatcagaagctatcagccgcaatca
cagcagcagtctgttcagcctcagcttcaatctatttcctctcttcctgccggtatacca
gacggaacaacacgaagaagaagaggaacggcaagaccgggatcaaaagcagctaagctg
cgtgaagctgctattaaaacattaaaacgccacaacgcggcgattaagagctcggagctt
caaaaagagattgaaaaagaaagcggtcttgaaatccctaatatgacaacgtttatgcaa
agcttaattaaaatgtacccggaagtgaaaaagccatatcgcgggcagtacattttagag
ggtgaaatcgaatctgcagaatcagcaaacgaataa

DBGET integrated database retrieval system