KEGG   Bacillus subtilis subsp. subtilis 168: BSU14310Help
Entry
BSU14310          CDS       T00010                                 

Gene name
moaD
Definition
(RefSeq) molybdopterin synthase sulfur carrier subunit
  KO
K03636  sulfur-carrier protein
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu04122  Sulfur relay system
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09123 Folding, sorting and degradation
   04122 Sulfur relay system
    BSU14310 (moaD)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: ThiS DUF1899 Big_6
Motif
Other DBs
NCBI-GeneID: 938785
NCBI-ProteinID: NP_389314
Pasteur: BG12619
BSORF: BG12619
UniProt: O31706
Position
1499432..1499665
Genome map
AA seq 77 aa AA seqDB search
MIKILLFAGLAEQAGTQAIEIDMEQATTDEIKASLKEQYGLESIDTAMIAVNESYVKENT
SVSSGDTVAIIPPVSGG
NT seq 234 nt NT seq  +upstreamnt  +downstreamnt
atgattaaaattcttttatttgcagggcttgctgaacaggccggtacacaagcaatagaa
atagatatggaacaagcaaccacagatgaaataaaagcgagtctaaaagaacaatacggt
cttgaatctattgatacggctatgattgccgttaacgaaagctatgtaaaagaaaatacc
tctgtatcttcgggtgacacggtagccatcataccgccggtcagcgggggatga

DBGET integrated database retrieval system