KEGG   Bacillus subtilis subsp. subtilis 168: BSU14460
Entry
BSU14460          CDS       T00010                                 

Gene name
ykpC
Definition
(RefSeq) hypothetical protein
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Motif
Pfam: YkpC Tubulin-binding
Other DBs
NCBI-GeneID: 938750
NCBI-ProteinID: NP_389329
Pasteur: BG11812
BSORF: BG11812
UniProt: Q45492 A0A6M3ZAB1
Position
complement(1516339..1516473)
AA seq 44 aa
MLRDLGRRVAIAAILSGIILGGMSISLANMPHSPAGGTVKLNHP
NT seq 135 nt   +upstreamnt  +downstreamnt
atgctaagagatttaggaagaagagtagcgatcgcagccattttaagcggaattattctt
ggaggcatgagcatttctttggcaaatatgccccattcgcctgcaggcggcactgtaaaa
ctgaatcatccataa

DBGET integrated database retrieval system