KEGG   Bacillus subtilis subsp. subtilis 168: BSU14460Help
Entry
BSU14460          CDS       T00010                                 

Gene name
ykpC
Definition
(RefSeq) hypothetical protein
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: YkpC DUF5316 Tubulin-binding
Motif
Other DBs
NCBI-GeneID: 938750
NCBI-ProteinID: NP_389329
Pasteur: BG11812
BSORF: BG11812
UniProt: Q45492
Position
complement(1516339..1516473)
Genome map
AA seq 44 aa AA seqDB search
MLRDLGRRVAIAAILSGIILGGMSISLANMPHSPAGGTVKLNHP
NT seq 135 nt NT seq  +upstreamnt  +downstreamnt
atgctaagagatttaggaagaagagtagcgatcgcagccattttaagcggaattattctt
ggaggcatgagcatttctttggcaaatatgccccattcgcctgcaggcggcactgtaaaa
ctgaatcatccataa

DBGET integrated database retrieval system