KEGG   Bacillus subtilis subsp. subtilis 168: BSU14569Help
Entry
BSU14569          CDS       T00010                                 

Gene name
ykzV
Definition
(RefSeq) hypothetical protein
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: YjcZ_2
Motif
Other DBs
NCBI-GeneID: 8303091
NCBI-ProteinID: YP_003097725
UniProt: C0H409
Position
complement(1526859..1527017)
Genome map
AA seq 52 aa AA seqDB search
MYGYGYGGGCCSYGGYGYGGCGYGYGRTFALIVVLFILLIIVGAAYLGGGCC
NT seq 159 nt NT seq  +upstreamnt  +downstreamnt
atgtatggatatggttacggcggaggctgctgcagttatggtggttacggatatggtggc
tgcggatatggctacggccgcacctttgcgctaatcgttgttttattcattctgttaatc
attgtcggagctgcttatttaggtggaggctgttgctaa

DBGET integrated database retrieval system