KEGG   Bacillus subtilis subsp. subtilis 168: BSU16890
Entry
BSU16890          gene      T00010                                 

Gene name
ymfK
Definition
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Other DBs
NCBI-GeneID: 939667
Pasteur: BG13431
Position
1760851..1761303
NT seq 453 nt   +upstreamnt  +downstreamnt
ttggcaaagctcgaatggtattttgaatatgaaattcaagtgaaccgccccggactgctc
ggggatatttcatctcttcttgggatgctttctatcaacatcgtaacgataaacggcgtc
gatctttccagaaggggaatgctcctcaggtgccgccatatagatcaaattaaacgatta
gaatcaatcttaaaaacgatggaaacaattaaagtaacgaagcttagagaaccgaggctt
cgcgaccgtcttgccgtacgccacggccgttatattcaacgggatgccgatgacaagaaa
acgttccgctttgaacgggacgagcttggcttattagtcgattttatggccgaattgttc
aaaaaagaaggccataaattaatcggaatcagaggtatgccgcgtgtcgggaaaacggaa
tcgattgtagcctctagtgtgtgcgagcaaaag

DBGET integrated database retrieval system