KEGG   Bacillus subtilis subsp. subtilis 168: BSU16900
Entry
BSU16900          gene      T00010                                 

Gene name
ymfK
Definition
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Other DBs
NCBI-GeneID: 939674
Pasteur: BG13432
Position
1761302..1761640
NT seq 339 nt   +upstreamnt  +downstreamnt
aggtggctgtttgtgtcatcaaccttgctgaagcagacgataagaagccagctgattgcc
gatgaatacagcactgaaaatgtctttatcgttgacggaattgtgtcaacacgaagaggg
tcagaacgccatctccagctggtccgagaaatcatgcggctgcctgcaacaaaagtggtg
gagcatccggacatattcgttcaaaatacagagtatacactagatgactttgattatatt
attgaactgagaaatgaccctgatgaggttattacatatgaacatgccgaggaaccccaa
atgtttgatcaatccgggttttcaagctttgatttttaa

DBGET integrated database retrieval system