KEGG   Bacillus subtilis subsp. subtilis 168: BSU17266
Entry
BSU17266          gene      T00010                                 

Gene name
ymzE
Definition
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Other DBs
NCBI-GeneID: 8302997
Position
1862937..1862993
NT seq 57 nt   +upstreamnt  +downstreamnt
atgaatttctacttgcaccgatctttggaaagccaaatgccaatcagcattatatat

DBGET integrated database retrieval system