KEGG   Bacillus subtilis subsp. subtilis 168: BSU17267
Entry
BSU17267          gene      T00010                                 

Gene name
ymzE
Definition
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Other DBs
NCBI-GeneID: 8303195
Position
1862992..1863168
NT seq 177 nt   +upstreamnt  +downstreamnt
atgaagaaagacggaacgattagtaaaagaacgattattgtgagacagaaaagcaaaacg
aaaatcaaagcattttgtttttcgaaacaacagatcagaacatttttattggactctatc
ctctcctgtgattttgtgagaacaaataagcaaaatctctattctgcaggccggtaa

DBGET integrated database retrieval system