KEGG   Bacillus subtilis subsp. subtilis 168: BSU17310
Entry
BSU17310          CDS       T00010                                 

Gene name
ymaG
Definition
(RefSeq) hypothetical protein
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Other DBs
NCBI-GeneID: 940062
NCBI-ProteinID: NP_389613
Pasteur: BG13415
BSORF: BG13415
UniProt: O31793
Position
complement(1865512..1865787)
AA seq 91 aa
MNELEHFSPEDTRIFGRPFGFGRPFGFGRPFGFGYGFGRPGFGYGFGRPFGFFGGPFIGG
LAGGLIGSALFNPYLYGGYPYYPYAPFPFYY
NT seq 276 nt   +upstreamnt  +downstreamnt
atgaacgagttagagcatttcagccctgaagatacaagaatatttggaaggccgttcgga
ttcgggagaccatttgggtttggaagaccgttcgggttcggttacgggtttggaagaccc
ggatttggttatgggtttggccggccattcggattttttggaggaccgtttatcggcggc
cttgcaggcgggcttataggaagcgctttatttaatccttatttgtatggcggatacccc
tattatccgtatgccccgttccctttttattattaa

DBGET integrated database retrieval system