KEGG   Bacillus subtilis subsp. subtilis 168: BSU17678Help
Entry
BSU17678          gene      T00010                                 

Gene name
ynzJ
Definition
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 8302988
Position
1901612..1901737
Genome map
NT seq 126 nt NT seq  +upstreamnt  +downstreamnt
ttgaacgttatggttaagattcaagagctctatgatgtgatttttcacactgcttttgaa
ggatttagagttagacatcaaaaacaaacagcaaaaccggctagaaacagatcatataag
gaatga

DBGET integrated database retrieval system