KEGG   Bacillus subtilis subsp. subtilis 168: BSU17700Help
Entry
BSU17700          CDS       T00010                                 

Gene name
cotC
Definition
(RefSeq) spore coat protein C
  KO
K06326  spore coat protein C
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09190 Not Included in Pathway or Brite
  09193 Unclassified: signaling and cellular processes
   99978 Cell growth
    BSU17700 (cotC)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 939543
NCBI-ProteinID: NP_389653
Pasteur: BG10492
BSORF: BG10492
UniProt: P07790
Position
complement(1904995..1905195)
Genome map
AA seq 66 aa AA seqDB search
MGYYKKYKEEYYTVKKTYYKKYYEYDKKDYDCDYDKKYDDYDKKYYDHDKKDYDYVVEYK
KHKKHY
NT seq 201 nt NT seq  +upstreamnt  +downstreamnt
atgggttattacaaaaaatacaaagaagagtattatacggtcaaaaaaacgtattataag
aagtattacgaatatgataaaaaagattatgactgtgattacgacaaaaaatatgatgac
tatgataaaaaatattatgatcacgataaaaaagactatgattatgttgtagagtataaa
aagcataaaaaacactactaa

DBGET integrated database retrieval system