KEGG   Bacillus subtilis subsp. subtilis 168: BSU18819
Entry
BSU18819          gene      T00010                                 

Gene name
yozU
Definition
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Other DBs
NCBI-GeneID: 8303075
Position
complement(2050373..2050585)
NT seq 213 nt   +upstreamnt  +downstreamnt
atggaagttgcgatagtaaacgacagtaaggataagtatatttatgctggaatccagaaa
gaagcggccttcaataatatatttgaaagcgcaaaaatgagtaagcggataatatcgagg
gctaccacatgcaaatatttgagaaagaataaaaagaaggttgaggaattggagaatgag
tatgctgctgttatgaattgcaaaaagaagtag

DBGET integrated database retrieval system