KEGG   Bacillus subtilis subsp. subtilis 168: BSU18909
Entry
BSU18909          gene      T00010                                 

Gene name
yozZ
Definition
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Other DBs
NCBI-GeneID: 8302924
Position
2061855..2061995
NT seq 141 nt   +upstreamnt  +downstreamnt
ttgactgtatttggtgacgatttaacagagaaatttaatgctcttctgacttttttaact
gcattgggcattattgttgatccaacaactcaaggtatttctgatagtgaacaagcaatg
gattatgattcaccgagataa

DBGET integrated database retrieval system