KEGG   Bacillus subtilis subsp. subtilis 168: BSU18979
Entry
BSU18979          gene      T00010                                 

Gene name
yoyA
Definition
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Other DBs
NCBI-GeneID: 8302978
Position
complement(2069262..2069561)
NT seq 300 nt   +upstreamnt  +downstreamnt
ttggctacagaaggatacgggggaaataactcagctcccagtagatccattggttttagt
gaattctgtgaaacacttgagaaaaatgaagtagttaaacccgagaacaaaaaaagctca
cttgacctaaataattctttagattattggaaatcaagatttaatccaggcggtaatctt
tcggcgttagattctcaggtattagatattatcaaaaaagcttacaacttaggcatggtt
aacaaagataatatgctgctgcgaaatgaagcaattaatgcttataaaaattcaatttaa

DBGET integrated database retrieval system