KEGG   Bacillus subtilis subsp. subtilis 168: BSU19749
Entry
BSU19749          CDS       T00010                                 

Gene name
yoyG
Definition
(RefSeq) hypothetical protein
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Motif
Pfam: YjcZ_2
Other DBs
NCBI-GeneID: 8302971
NCBI-ProteinID: YP_003097746
UniProt: C0H435
Position
complement(2145820..2145933)
AA seq 37 aa
MYGYSGYGYGFGCGTNTFVLIVVLFILLIIVGAAFIC
NT seq 114 nt   +upstreamnt  +downstreamnt
atgtatggatactctgggtacggttacggatttggctgcgggacaaatacatttgtgtta
attgttgtcttgttcattttattaattattgttggagccgcttttatttgctag

DBGET integrated database retrieval system