KEGG   Bacillus subtilis subsp. subtilis 168: BSU19780
Entry
BSU19780          CDS       T00010                                 

Gene name
cgeA
Definition
(RefSeq) spore maturation protein CgeA
  KO
K06319  spore maturation protein CgeA
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09190 Not Included in Pathway or Brite
  09193 Unclassified: signaling and cellular processes
   99978 Cell growth
    BSU19780 (cgeA)
SSDB
Other DBs
NCBI-GeneID: 940066
NCBI-ProteinID: NP_389859
Pasteur: BG11193
BSORF: BG11193
UniProt: P42089 A0A6M3ZHU8
Position
2148676..2149077
AA seq 133 aa
MSSENAQLKKDLIKAVLSPLFPTATEGGENMDSNLKALLDAAIDQKVDESETVTAESILD
PSLPARWIFARITPGTTISIVTDSGDMIGPVVFVAFDQVHGIVFVTQESSVTPAGQATTL
IDVDKVESVTFFS
NT seq 402 nt   +upstreamnt  +downstreamnt
atgagctctgaaaatgcacagttaaaaaaggatttaattaaagccgttttaagcccttta
tttccaactgcaacagaaggaggagaaaatatggatagtaatcttaaagccttgcttgat
gctgccatcgatcaaaaagtagatgaaagtgaaacggttacggcagaatctattttagac
ccttctcttccggcaagatggatttttgccagaattacgccaggcactacaatcagcatt
gtgactgattcaggtgacatgatcggaccggttgttttcgttgctttcgatcaggttcac
gggatcgtatttgtaacacaggaaagctccgtcactccggcaggccaagctacaacatta
attgatgtagacaaagtagaaagcgttacgttcttttcataa

DBGET integrated database retrieval system