KEGG   Bacillus subtilis subsp. subtilis 168: BSU19810
Entry
BSU19810          gene      T00010                                 

Gene name
ypqP
Definition
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Other DBs
NCBI-GeneID: 940069
Pasteur: BG13547
Position
2151626..2152045
NT seq 420 nt   +upstreamnt  +downstreamnt
atgcctaaacagcaaacagcagaactaaaaccatttttccataacaaaacagttttagtc
actggcggaacgggttcaatcgggagtcaaattgtcaaacgccttttgatgcttacacct
aaacaggtgattgtattcagcaaagacgacagtaaacagtatgtcatgagccaaaagtat
gcggaggataagcggctattatttgtacttggagatgtacgcgatcacagaagggtgaat
caggtgatgaaaggcgtcgatatcgtctttcacgcggctgcgctgaaacaggttccgaca
tgtgaggaccatccatttgaagcgatccagaccaatctcatcggcggacaaaatgtggtg
gaagctgccctttcacaccgagtgcagcatgtcattaatatcagtacagataaagctgta

DBGET integrated database retrieval system