KEGG   Bacillus subtilis subsp. subtilis 168: BSU19900
Entry
BSU19900          CDS       T00010                                 

Gene name
yotF
Definition
(RefSeq) hypothetical protein
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Other DBs
NCBI-GeneID: 940086
NCBI-ProteinID: NP_389871
Pasteur: BG13739
BSORF: BG13739
UniProt: O31869
Position
complement(2154596..2154673)
AA seq 25 aa
MENVMSWFNIDFEIKSDNNIDKTLL
NT seq 78 nt   +upstreamnt  +downstreamnt
atggagaacgtaatgtcctggtttaatatagactttgaaattaaatcagacaataacatt
gataaaactttattgtga

DBGET integrated database retrieval system