KEGG   Bacillus subtilis subsp. subtilis 168: BSU19910
Entry
BSU19910          CDS       T00010                                 

Gene name
yotE
Definition
(RefSeq) hypothetical protein
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Other DBs
NCBI-GeneID: 939566
NCBI-ProteinID: NP_389872
Pasteur: BG13738
BSORF: BG13738
UniProt: O31870
Position
complement(2154705..2154851)
AA seq 48 aa
MKEIEFEEVKKFVEVMSRRLRSTKVIKIHISYAEWLVAEVERLRGLVK
NT seq 147 nt   +upstreamnt  +downstreamnt
atgaaagagattgaatttgaagaagttaaaaaatttgttgaagtaatgtctcggcgactt
agatcaaccaaggtgataaaaattcatatcagttatgcagaatggttagttgcagaagtc
gaacgcttaagggggttagtcaagtga

DBGET integrated database retrieval system