KEGG   Bacillus subtilis subsp. subtilis 168: BSU20190Help
Entry
BSU20190          CDS       T00010                                 

Gene name
yosA
Definition
(RefSeq) hypothetical protein
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: YjcZ_2
Motif
Other DBs
NCBI-GeneID: 939574
NCBI-ProteinID: NP_389901
Pasteur: BG13710
BSORF: BG13710
UniProt: O31888
Position
2169807..2169926
Genome map
AA seq 39 aa AA seqDB search
MGFYSGYSGGYSGGGYGSSFVLIVVLFILLIIVGATFLY
NT seq 120 nt NT seq  +upstreamnt  +downstreamnt
atgggattctacagcggatattctggtggatactctggcggcggatacggaagcagcttc
gtcttgatcgttgtgttattcatcctattgatcattgttggtgctacattcctatactaa

DBGET integrated database retrieval system