KEGG   Bacillus subtilis subsp. subtilis 168: BSU20190
Entry
BSU20190          CDS       T00010                                 

Gene name
yosA
Definition
(RefSeq) hypothetical protein
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Motif
Pfam: YjcZ_2
Other DBs
NCBI-GeneID: 939574
NCBI-ProteinID: NP_389901
Pasteur: BG13710
BSORF: BG13710
UniProt: O31888 A0A6M3ZCE3
Position
2169807..2169926
AA seq 39 aa
MGFYSGYSGGYSGGGYGSSFVLIVVLFILLIIVGATFLY
NT seq 120 nt   +upstreamnt  +downstreamnt
atgggattctacagcggatattctggtggatactctggcggcggatacggaagcagcttc
gtcttgatcgttgtgttattcatcctattgatcattgttggtgctacattcctatactaa

DBGET integrated database retrieval system