KEGG   Bacillus subtilis subsp. subtilis 168: BSU21599Help
Entry
BSU21599          gene      T00010                                 

Gene name
yoyK
Definition
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 8303038
Position
2278340..2278456
Genome map
NT seq 117 nt NT seq  +upstreamnt  +downstreamnt
aatattagccatggttattcatttgaagctcttagagcaaaaatattgtttacacaaggt
tatcgtaaagtaaaaaagaaattcaaagaagttgaagctactttcggaaaattgtga

DBGET integrated database retrieval system