KEGG   Bacillus subtilis subsp. subtilis 168: BSU21670Help
Entry
BSU21670          gene      T00010                                 

Gene name
ypqP
Definition
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 939107
Pasteur: BG11629
Position
2286448..2287053
Genome map
NT seq 606 nt NT seq  +upstreamnt  +downstreamnt
tctcctgtgaacacaatgggtgccaccaagctgttatctgaaaagctgtttcatcaagca
aaccgccacgtccaaaacaaaggaaccttgttttgttcggtccgctttggaaatgttctc
ggttccagaggttcggtcatccccatattatttgaacagatgatggagggtgaacctctg
accatcacagacaaaaacatgaccagatttttcatgtcaatagacgatgcagctacattg
acattacaatcggctgctattacaaaaggcggagaaacctttattttcaaaatggaatca
ctgaaacttgaagaactgattcatgggtttgaagaatatgcatcgcagcacgggctcccg
cggccggctgcagtagaagtgggcaagcgtccaggtgaaaagcttcacgaagaattaaca
tctccacatgaaattgaatcactgtatgaatggggcaacctttatgcgatccttccagag
ccggaaaaacatcctgactttcgcaaagtcaatctgcctgggtatcaatcagatcaagcc
ccgctcattacgaaagaaagaattgctcagattattgaagaattgcatcaagagaaaaag
gcataa

DBGET integrated database retrieval system