KEGG   Bacillus subtilis subsp. subtilis 168: BSU22290
Entry
BSU22290          CDS       T00010                                 

Gene name
sspM
Definition
(RefSeq) small acid-soluble spore protein M
  KO
K06430  small acid-soluble spore protein M (minor)
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09190 Not Included in Pathway or Brite
  09193 Unclassified: signaling and cellular processes
   99978 Cell growth
    BSU22290 (sspM)
SSDB
Other DBs
NCBI-GeneID: 2914288
NCBI-ProteinID: YP_054585
Pasteur: BG14177
BSORF: BG14177
UniProt: Q7WY65 A0A6M3ZGM4
Position
2339670..2339774
AA seq 34 aa
MKTRPKKAGQQKKTESKAIDSLDKKLGGPNRPST
NT seq 105 nt   +upstreamnt  +downstreamnt
atgaaaacaagaccgaaaaaagccggccagcaaaaaaagactgaatcaaaggcaatcgat
tctttagataaaaaattaggcggcccgaaccgcccttctacgtaa

DBGET integrated database retrieval system