KEGG   Bacillus subtilis subsp. subtilis 168: BSU23329
Entry
BSU23329          gene      T00010                                 

Symbol
ypuC
Name
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Other DBs
NCBI-GeneID: 8302975
Position
complement(2433631..2433885)
NT seq 255 nt   +upstreamnt  +downstreamnt
ttgtcatttttggtttttgtgcttatctttttgttcgtcattctcacaagacgcgtctgc
aaactgttgcatttttttgtttattatcgttttattcctcatcgggctgagccgtgtgta
ctttatgagcagtatccgagtgatgttgctgcgggttacgccttcggcggtgtttggctg
agtttgaatgttttggtcatggagcttttccgtttctccagaagatttaccaagctgaga
aacgaacccaattag

DBGET integrated database retrieval system