KEGG   Bacillus subtilis subsp. subtilis 168: BSU23330
Entry
BSU23330          gene      T00010                                 

Symbol
ypuC
Name
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Other DBs
NCBI-GeneID: 938938
Pasteur: BG10514
Position
complement(2433878..2434165)
NT seq 288 nt   +upstreamnt  +downstreamnt
atgtcgtattggatcgggtatagactgggcccagctgcaattcagaaagcttttgcgtcg
agaggtgttctgttagccgttattgttctaacttttttttggacggtattcagagggcaa
gatcggaaaatcgaactctctttcttatttttcctagtcattggtggggagctttatgaa
gagggaatcagacggctctttcattcccttcatcctgttcacgctcctttggaaagtcat
gtattatatccattcccgagcgaacagactttaacggcatttgtcatt

DBGET integrated database retrieval system