KEGG   Bacillus subtilis subsp. subtilis 168: BSU24820
Entry
BSU24820          CDS       T00010                                 

Gene name
yqgU
Definition
(RefSeq) lipoprotein
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Other DBs
NCBI-GeneID: 938213
NCBI-ProteinID: NP_390362
Pasteur: BG11688
BSORF: BG11688
UniProt: P54498 A0A6M3ZJ22
Position
complement(2566237..2567298)
AA seq 353 aa
MLMRSVCFILLAVLLFSLSACEPSHQQQKQASAAKDEKKDIIPLSAEKADGAEGWLNNST
ILYTASNPTKTELFAYRIFTGKAKKLYQTDGQIVDVQINAREQMILLQITHSQKTAVVLL
NAEGETLYEKDYETYELEAAWNQYDPYQMMVTEFNENWDFHTYQVNAKKDESFLSPVQVP
FIHWTSKNTFDYVKEGRDDKTGPLYTFDTASKTEQKLEDNVLFFDSFHQMSFTVKSASGG
KGTYQFKTPQSTSPVTAKWPLQAKYTSLAPMEYDYDEAGGLFYTFKQSGDAYKLAAINVA
SGETKDLVSLREMEPIQISPNGKYALYGFHFEQIILLKSHETKQLIIDQKEME
NT seq 1062 nt   +upstreamnt  +downstreamnt
atgctgatgagatcagtttgttttattctgctggcggtattgctgtttagtttatcggca
tgcgaaccatctcatcagcagcaaaaacaggcatcggcggcaaaagatgagaaaaaagac
atcataccgctttccgcggaaaaagcggatggggcggaaggctggctgaataacagcaca
atattatatactgcgtctaatccgacgaaaacagagctttttgcgtaccgcatctttaca
ggcaaagcgaaaaagctctatcaaacggatggtcaaatcgttgatgttcaaatcaatgcg
agggagcagatgattctgctgcaaatcacacatagccaaaagacggcagtggttttgctt
aatgcagaaggagagacgctttacgaaaaagattacgaaacgtatgagcttgaagctgct
tggaatcagtatgatccttatcaaatgatggtgacggaattcaatgaaaactgggatttc
catacatatcaggtgaatgctaaaaaagacgaatctttcttaagcccagtacaggttccg
ttcattcattggacatccaaaaatacatttgattatgtaaaagagggtagagacgataaa
acagggcctttatatacgttcgatacagcttctaagacggaacagaagcttgaggataac
gttctattcttcgattctttccatcaaatgagttttactgtcaaatcagcttccggagga
aaagggacgtatcagtttaaaacgccgcaatcaacatcacctgttacagcgaaatggccg
ctccaagcgaaatatacaagtttggctccaatggagtatgactatgatgaagcaggaggc
ctgttttatacattcaaacaaagcggcgatgcatataagctcgcagcaatcaatgtagca
tcgggagagacaaaagatcttgtgtctctgcgggaaatggagccgattcaaatatctccg
aacgggaaatatgcgttatacggctttcattttgagcaaattattttattgaaatcacat
gaaacgaagcaactcatcattgatcaaaaggagatggaataa

DBGET integrated database retrieval system