KEGG   Bacillus subtilis subsp. subtilis 168: BSU25760
Entry
BSU25760          gene      T00010                                 

Symbol
spoIVCB
Name
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Other DBs
NCBI-GeneID: 937803
Pasteur: BG10459
Position
2652993..2653463
NT seq 471 nt   +upstreamnt  +downstreamnt
atggtgacaggtgttttcgcagcgctcggctttgttgttaaagagcttgtctttttagta
tcttacgtgaaaaacaatgcctttccacaaccgctctcaagcagcgaagaaaaaaaatac
ttagagctcatggctaaaggggatgaacatgccagaaacatgctgattgagcataatctt
cgcttggtcgcccatattgtgaaaaagttcgaaaatacaggtgaggatgcagaggactta
atctccatcggaacgatcgggcttattaaaggaattgaaagctattccgctggaaaaggg
acaaagctggcgacgtatgcagcgaggtgtattgaaaatgagattgtaattacaaaaggg
gggtgcatacacccctctttaatacgtttcaatatatatggtgtcagaatccacaatggt
aacttctttcacgataaagttaacaattgtttttttatcttcaagagttaa

DBGET integrated database retrieval system