KEGG   Bacillus subtilis subsp. subtilis 168: BSU25840
Entry
BSU25840          CDS       T00010                                 

Gene name
phrE
Definition
(RefSeq) phosphatase RapE inhibitor
  KO
K06354  phosphatase RapE regulator
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu02024  Quorum sensing
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09140 Cellular Processes
  09145 Cellular community - prokaryotes
   02024 Quorum sensing
    BSU25840 (phrE)
SSDB
Other DBs
NCBI-GeneID: 937784
NCBI-ProteinID: NP_390461
Pasteur: BG11521
BSORF: BG11521
UniProt: O32025 A0A6M4JNH7
Position
2660330..2660464
AA seq 44 aa
MKSKLFISLSAVLIGLAFFGSMYNGEMKEASRNVTLAPTHEFLV
NT seq 135 nt   +upstreamnt  +downstreamnt
atgaaatctaaattgtttatcagtttatccgccgttttaattggacttgcctttttcgga
tctatgtataatggcgaaatgaaggaagcatcccggaatgtaactctcgcacctactcat
gaattccttgtttaa

DBGET integrated database retrieval system