KEGG   Bacillus subtilis subsp. subtilis 168: BSU26000Help
Entry
BSU26000          CDS       T00010                                 

Gene name
yqbR
Definition
(RefSeq) hypothetical protein
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: DUF2577
Motif
Other DBs
NCBI-GeneID: 937750
NCBI-ProteinID: NP_390477
Pasteur: BG11289
BSORF: BG11289
UniProt: P45933
Position
complement(2670801..2671064)
Genome map
AA seq 87 aa AA seqDB search
MRLSEAIKHLAVRAVDSESPVDILPAEVVSVSPVEIRLNENDKLIIPADLIIVPKRLRAG
EEALNTGERVMIVSLKGGQSFFILDKI
NT seq 264 nt NT seq  +upstreamnt  +downstreamnt
atgagattaagtgaagcaatcaaacatttggctgtccgtgcagttgattctgagtcgcca
gtggatattctaccggctgaagtggtttccgtttcccctgttgaaataaggcttaatgaa
aatgacaaattaataatacctgctgatttgattattgttccaaagcggctgcgggccggt
gaagaagcattaaatacaggtgagcgtgtgatgattgtctccttaaaaggcgggcaatca
ttttttattctcgacaaaatatag

DBGET integrated database retrieval system