KEGG   Bacillus subtilis subsp. subtilis 168: BSU26040
Entry
BSU26040          gene      T00010                                 

Symbol
yqbN
Name
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Other DBs
NCBI-GeneID: 937749
Pasteur: BG11285
Position
complement(2677657..2678094)
NT seq 438 nt   +upstreamnt  +downstreamnt
atgagtgaaaaacaaaacgaaaaagtatacgatctttcattctttatgccaggacaaaca
attgaagcggaagaggtagaagttccgatttctaaacggtttgtagacaaagaaggcaat
gttgttccattcattttcaaagcaattacgactgaacgaattgacgaacttgagaaagag
aacaccacttacaaaaatgtaaaaggccgcggccgtgtgaaggagttggacagccaacgc
ttttatgctcgtattgcggttgaaacgactgtttatccgaactttaaagctaaggaacta
cgtgaggcttacaaaacagaagatccagtggaagtcgccaaacgtgttctttcagtcggc
ggtgaatatgcaaattggctgaacaaagcaattgaaatcaacggttttgatgatgatctc
gaagaccttgaagaagca

DBGET integrated database retrieval system