KEGG   Bacillus subtilis subsp. subtilis 168: BSU26390
Entry
BSU26390          gene      T00010                                 

Symbol
spoIIIC
Name
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Other DBs
NCBI-GeneID: 937666
Pasteur: BG10919
Position
2701338..2701754
NT seq 417 nt   +upstreamnt  +downstreamnt
atgccccccctttttgtaatgaataatgaaatcctcatgcatttgcgcgcattgaaaaaa
acaaaaaaagacgtctcccttcacgatccgatcgggcaggataaggaagggaatgaaata
agcctgattgacgttttgaaatcagaaaacgaagacgtgatagatacgatccagctcaat
atggagcttgaaaaagtgaaacaatacattgacattttagatgaccgtgagaaggaagtg
attgtcgggcggtttggacttgatttgaagaaggaaaaaacgcagcgagagattgccaaa
gaactcggtatctcacgcagctatgtatcgcggattgaaaagcgggcgctgatgaagatg
tttcatgagttttatcgggcagagaaggaaaagcggaagaaggcgaaggggaaataa

DBGET integrated database retrieval system