KEGG   Bacillus subtilis subsp. subtilis 168: BSU26558
Entry
BSU26558          gene      T00010                                 

Symbol
yrzM
Name
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Other DBs
NCBI-GeneID: 8302949
Position
complement(2714231..2714548)
NT seq 318 nt   +upstreamnt  +downstreamnt
gtgattatcattgcaacgtatagacgttattatcctataaccggaatctcttgtatccat
aaagataaattagaggctatggacatcacaatattagatattcgtcattataacgatgta
gccaatttttcggataatattattttaaacatcccatatgcgtatctaaaacgtttttat
ttagagattccacgtgataaaatacacataatagctcgtgaccgggtggaattaaattta
ggagtgcgttttctaaagcgcaaaggtatccatgtaaacagttatgaactggcaacatgt
aaatgtaaaaataaatga

DBGET integrated database retrieval system