KEGG   Bacillus subtilis subsp. subtilis 168: BSU26748
Entry
BSU26748          gene      T00010                                 

Symbol
yrdD
Name
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Other DBs
NCBI-GeneID: 8302918
Position
complement(2732389..2732547)
NT seq 159 nt   +upstreamnt  +downstreamnt
atagaagtattaggagtttcgccattttatcagggaaagagtttaggcagcaaaatgatt
aatgactgtctcatatcttttatttcaaaatgcggggacggcattttggcccttatcatg
aatactgatctcaatggatcattttacaaatcgtcctga

DBGET integrated database retrieval system