KEGG   Bacillus subtilis subsp. subtilis 168: BSU26750
Entry
BSU26750          gene      T00010                                 

Symbol
yrdD
Name
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Other DBs
NCBI-GeneID: 937978
Pasteur: BG12284
Position
complement(2732747..2732881)
NT seq 135 nt   +upstreamnt  +downstreamnt
atgtttctttatcgacaagcaagagcagatgaagtaagcaaagtggcaaagctattccat
caatctttcaatcaatatccttttatggatttactcgtaaaacgcgaaaaaaagatcatt
catttatttttgaaa

DBGET integrated database retrieval system