KEGG   Bacillus subtilis subsp. subtilis 168: BSU27009
Entry
BSU27009          gene      T00010                                 

Symbol
yrzP
Name
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Other DBs
NCBI-GeneID: 8302927
Position
2755987..2756181
NT seq 195 nt   +upstreamnt  +downstreamnt
atggcaaataaacacactgccggaagagaacaattaggagaatttgcgccaaagtttgct
gaacttcatgatgatgttctattcggtgacatttgggcaagagaagaagaactttcatcc
cgggatcgcagcatgattacagtttctgcattaattactgactgtttctcagcttataaa
tcaggttcattttaa

DBGET integrated database retrieval system