KEGG   Bacillus subtilis subsp. subtilis 168: BSU32469
Entry
BSU32469          CDS       T00010                                 

Gene name
yuzJ
Definition
(RefSeq) hypothetical protein
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Motif
Pfam: YjcZ_2
Other DBs
NCBI-GeneID: 8303056
NCBI-ProteinID: YP_003097780
UniProt: C0H3Q7 A0A6M3ZG36
Position
3335414..3335545
AA seq 43 aa
MGFYNSGGYSGNSGYSNGFGSSFALIVVLFILLIIVGAAIFNY
NT seq 132 nt   +upstreamnt  +downstreamnt
atgggattctacaattctggtggatacagtggaaactctggttactcaaacggtttcggg
agctccttcgctttgatcgtggtgctattcattttgttgatcattgttggagcagctatc
tttaattattaa

DBGET integrated database retrieval system