KEGG   Bacillus subtilis subsp. subtilis 168: BSU32469Help
Entry
BSU32469          CDS       T00010                                 

Gene name
yuzJ
Definition
(RefSeq) hypothetical protein
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: YjcZ_2 Phage_Gp23 Shisa
Motif
Other DBs
NCBI-GeneID: 8303056
NCBI-ProteinID: YP_003097780
UniProt: C0H3Q7
Position
3335414..3335545
Genome map
AA seq 43 aa AA seqDB search
MGFYNSGGYSGNSGYSNGFGSSFALIVVLFILLIIVGAAIFNY
NT seq 132 nt NT seq  +upstreamnt  +downstreamnt
atgggattctacaattctggtggatacagtggaaactctggttactcaaacggtttcggg
agctccttcgctttgatcgtggtgctattcattttgttgatcattgttggagcagctatc
tttaattattaa

DBGET integrated database retrieval system