KEGG   Bacillus subtilis subsp. subtilis 168: BSU32640Help
Entry
BSU32640          CDS       T00010                                 

Gene name
sspG
Definition
(RefSeq) small acid-soluble spore protein G
  KO
K06424  small acid-soluble spore protein G (minor)
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09190 Not Included in Pathway or Brite
  09193 Unclassified: signaling and cellular processes
   99978 Cell growth
    BSU32640 (sspG)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 2914218
NCBI-ProteinID: YP_054592
Pasteur: BG14173
BSORF: BG14173
UniProt: Q7WY59
Position
3354066..3354212
Genome map
AA seq 48 aa AA seqDB search
MSENRHENEENRRDAAVAKVQNSGNAKVVVSVNTDQDQAQAQSQDGED
NT seq 147 nt NT seq  +upstreamnt  +downstreamnt
atgagcgaaaatcgtcatgaaaatgaagaaaacagacgcgatgcggcagtggcaaaagtc
caaaacagcggtaatgcaaaagtcgtggtcagcgtgaacacagatcaggatcaggcacag
gcgcagtcacaagacggagaagactaa

DBGET integrated database retrieval system