KEGG   Bacillus subtilis subsp. subtilis 168: BSU32960Help
Entry
BSU32960          gene      T00010                                 

Gene name
yusY
Definition
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 938467
Pasteur: BG14036
Position
complement(3380704..3382212)
Genome map
NT seq 1509 nt NT seq  +upstreamnt  +downstreamnt
ggcctcatgaatcggctttccgcagattttcaatcgtcgctcgttacattagatcataaa
cttgtggacattaatcaagacgtgtggaatgaattgttaacaaaaccgggattgcgcgat
gtttcttacatattaaatgaaagaagacagagggttgccgaaaagcttagccccggtaag
gaaaaactgatcggaaaccttgcggtggacggatatcacgcttggagtgacttatacaat
atggttgtcgggaaaatgacgatcccgtatgaggaaaacggtgaaaacaagcaattgtct
gtcggtcaggcggagaatatgatggatcatcaagaccgtactgtcagaaaaacagtatat
gaacgtttccgccaagcttgggagagcaagcaagatattttcagcagcacgctgaatcat
ttggcgggattccggcttgaaacctataaagcgcgcggctgggagaatgtcctgaaggaa
ccgctgcaaattaacaggatgaaaaaagaaacacttgatacgatgtggcaggtcatcact
gaaaacaagaagccgttcgttcagtttttgaaccggaaagcatccatgctcggccttgaa
aaactcagctggtacgatgtcgaggcaccgatcggttctgacggaaaggtctattcgtat
gatgaagccgcaaatatcattaccagccagttttcaacgtttggcaaaaagctgtcctca
ttcactgaaaaagcgtttcgggacggctggattgaggcggaagacaggagcggaaaaaga
gtcggcggcttttgcaccagttttccggacagcggggaatcccggattttcatgacattt
tcgggaagcgcctcaaatgtctctacccttgcgcatgaactcgggcacgcgttccatcag
gaagcaatgctcaacgtcaggccgttaaaccgttcctacgccatgaacgttgcagaaaca
gcttcaacgtttgcagagatgatagtggcggacgcgactgtccagcaggccgagacgagg
gaagaaaagcttgttcttctggaggataaagtgcaaagaagcgttgcgttcttcatgaac
attcacgcaagatttctatttgaaacgagattctacgaggaacgaaagcggggagtggta
ccggccagccgcttgaatgagctgatggaagaggcgcaaagagaggcatactgcaatgcg
ttagaagaatatcatccgcttttttgggcatcaaagcttcattttcacatcacgagggtg
ccgttttacaatttcccttatacattcggctacctgttttctcttggtatttacgcgttg
gcgcttgaagaaaaagacacattcgaagagaagtatatggcgctattgcgcgatacggct
tctatgacagtggaggatttggcgatgaagcatttgggcgctgacatcacaaagcgcgat
ttctgggagaatgccatcaagctggctgtgcgtgacgccgaaacctttttacaaatgacc
gaatcttaa

DBGET integrated database retrieval system