KEGG   Bacillus subtilis subsp. subtilis 168: BSU32970Help
Entry
BSU32970          gene      T00010                                 

Gene name
yusY
Definition
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 938589
Pasteur: BG14037
Position
complement(3382209..3382499)
Genome map
NT seq 291 nt NT seq  +upstreamnt  +downstreamnt
atggcgctgcaaggggtaggccaaagatgggatcttgattcattttttaagggcgggagc
caatcggaagaattcaaaggttatattgagaagctgtcacaaagtctgcgtgcatttcaa
gacaggactgatgcgtttcaggtgcctgaatcgcctgaagaggctgaagggctgaccgcg
ttgcttgatttattcgaacagacatccgtcaagcttcagcaggccggcgcttttgttgct
tgcctccaggcccagaatatcaatgatcaaaaggctatagagcatcaggcc

DBGET integrated database retrieval system