KEGG   Bacillus subtilis subsp. subtilis 168: BSU35230Help
Entry
BSU35230          gene      T00010                                 

Gene name
swrAA
Definition
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 936672
Pasteur: BG14160
Position
complement(3621618..3621956)
Genome map
NT seq 339 nt NT seq  +upstreamnt  +downstreamnt
ttgtgcgtgaaaaaaaaatattatgaattagtggaacaattaaaagacagaacacaagac
gtaacattttcagctacaaaagcactaagtcttcttatgctgttcagcagatatttggtc
aattacaccaatgtcgaatcagtaaatgacattaatgaggaatgcgccaaacattatttt
aactacttaatgaaaaaccataagcgattaggaattaatctgacagatataaaaaggtcg
atgcatctaatcagcgggttattggatgtggatgtaaaccactatttaaaggatttttca
ctatcgaatgtcacgctgtggatgacgcaagagagataa

DBGET integrated database retrieval system