KEGG   Bacillus subtilis subsp. subtilis 168: BSU35239Help
Entry
BSU35239          gene      T00010                                 

Gene name
swrAA
Definition
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 8302919
Position
complement(3621931..3622047)
Genome map
NT seq 117 nt NT seq  +upstreamnt  +downstreamnt
atgcttgttagcactccagtactgctgcttatactggcccgtgcttatctgtataaagaa
aatgggggttcacaattgaagagggcaagtattgtgcgtgaaaaaaaaatattatga

DBGET integrated database retrieval system