KEGG   Bacillus subtilis subsp. subtilis 168: BSU35609
Entry
BSU35609          gene      T00010                                 

Symbol
tuaA
Name
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB
Other DBs
NCBI-GeneID: 8302930
Position
complement(3658259..3658408)
NT seq 150 nt   +upstreamnt  +downstreamnt
tgggctcaggtgaacggcggttacgatatgacgccgaaggaaaagctgatatttgattta
tattacattcgcaatctgactttcactttagaattaaaaattatgttaaaaacttgtaaa
gtagtttggacgggtgatggtgcaagataa

DBGET integrated database retrieval system