KEGG   Bacillus subtilis subsp. subtilis 168: BSU35609Help
Entry
BSU35609          gene      T00010                                 

Gene name
tuaA
Definition
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 8302930
Position
complement(3658259..3658408)
Genome map
NT seq 150 nt NT seq  +upstreamnt  +downstreamnt
tgggctcaggtgaacggcggttacgatatgacgccgaaggaaaagctgatatttgattta
tattacattcgcaatctgactttcactttagaattaaaaattatgttaaaaacttgtaaa
gtagtttggacgggtgatggtgcaagataa

DBGET integrated database retrieval system