KEGG   Bacillus subtilis subsp. subtilis 168: BSU35610Help
Entry
BSU35610          gene      T00010                                 

Gene name
tuaA
Definition
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 936769
Pasteur: BG12688
Position
complement(3658407..3658892)
Genome map
NT seq 486 nt NT seq  +upstreamnt  +downstreamnt
gtgagtgcagagaaaagcatgaatgtgagtcgtgaattctcagttcaacaaatacattct
tttacattatctgaaaagacggctcgttatttggcaataaagcgcgtaatggatatttgg
tttgcgctcattggattggcgattgcgctgccaatgattgcggtattttcaattttgatt
tgtttggagacgccggggcctgccatttatacgcaggaacgcgtagggaaaggcgggaag
ccatttaagctttataagcttcgttccatgaaaatagatgccgagaagtctggggcggtt
tgggcacagaagcaagatccgcgggtgacaaggatcggagcttttatcagaagaacgaga
attgacgagcttcctcagctgtttaatgtgctgaaaggcgatatgagtatgattggccct
cgtccggaacggcccgtatttacggaaaaattccagaatgagattccaggctttacacag
cgtctg

DBGET integrated database retrieval system