KEGG   Bacillus subtilis subsp. subtilis 168: BSU35699Help
Entry
BSU35699          gene      T00010                                 

Gene name
yvzE
Definition
(RefSeq) pseudogene
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 8303155
Position
3672929..3673525
Genome map
NT seq 597 nt NT seq  +upstreamnt  +downstreamnt
gtgataagtttctttcactatatcctccaaaaagaacctaaaggtcttggacatgctgtc
tggttcgcgcctaactttatcggcgatgagccgtttgcgtttctgcttggagacgatatt
gttcaggctgacacaccagggttgcgccaattaacggatgaatatgaaagaacactttct
tctattatcggtgttcagcaagtgcctgaagatgaaacacactgttatggcatcatcgcc
ccgctgacaagtgaaggccgccgttatcaggtgaaaaacttcattgaaaaaccgcctaaa
gacacagcaccttctaatcttgccatcttaggccgttacgtattcacgcctgagattttc
atgtatttagaggagcagcaggttggcgccggcggagaaattcagcttacagacgccatt
caaaaactgaatgaaattcaaagagtgtttgcttacgattttgaaggcaagcgttatgat
gttggtgaaaagctcggcttcatcacaacaactcttgaatttgcgatgcaggataaagag
cttcgcgatcagctcgttccatttatggaaggtttactaaacaaagaagaaatctaa

DBGET integrated database retrieval system