KEGG   Bacillus subtilis subsp. subtilis 168: BSU36200Help
Entry
BSU36200          CDS       T00010                                 

Gene name
ywqI
Definition
(RefSeq) hypothetical protein
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: DUF5344
Motif
Other DBs
NCBI-GeneID: 937912
NCBI-ProteinID: NP_391501
Pasteur: BG12513
BSORF: BG12513
UniProt: P96721
Position
complement(3727427..3727687)
Genome map
AA seq 86 aa AA seqDB search
MSEIKLKYDTVIKTLDSVKDALADVSIGAAGSNGKNSLDYTKKYHEREENIKTMLGDYKK
AVQKNIEDTKDNVDSLKEQDEAIAVK
NT seq 261 nt NT seq  +upstreamnt  +downstreamnt
atgtcagaaattaagctgaagtacgacacagtcatcaaaacattagattctgtcaaagat
gcgcttgctgacgtatcaatcggcgccgcaggatccaacggaaaaaacagcctcgattat
acgaaaaaataccatgagcgtgaggagaacatcaaaaccatgctcggagattacaaaaaa
gcggtacagaaaaatatcgaggatacaaaggataacgtagattcactcaaagagcaggac
gaggcgatagcggtaaaatag

DBGET integrated database retrieval system